Detailed Information [113916]

Strain Information
DGRC Number 113916
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}jing[NP6322] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}jingNP6322 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 42C1
Map Viewer
Related Genes CG15234 jing
Original Number 6322
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6322

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 534
General Information NP_lines
Lethality lethal
Larval GFP weak muscle, gut
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np48185_0912
Strand Minus
Insertion Point 1673980
Chromosome Band 2R
Flanking Sequence
ttnacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgCTCTCCACATCTTTCTTTATTTACAGAAACAACGATGAGAAA
GAAGAAGAAGAAGACGAAGCATGGAAGGCAAGGGCCGCAATCTAATGCGGGAAAATTTCA
GTTTCAGGTAGCCCCAAGTCGCGTGTGTGTTTGTGCGGTTTCGGTTAAACACATGTACAT
GTGAAACGGGATAAACGTCGGCAAGTATACAAAAAATCCTCTGGTTACACAAAAAGGGTA
TTTTTGAATTCGGTCTGCTATTTTGGTGCTCGAAAAGATATACAAATAGATGATACTTTT
TCACTTTTGGAACACGCAAAAGTTTACAAGCTTATTAAAAAATGAATTTAAAACGCTAAA
AACTTTAAATATACAATACATAAGTGCAGAATAAATACAATGCCATTTATCCATCAATTG
AATAACTAAAACGAAGCAAGCGTGCTTTCTACATATTGTCTTTCACATATGTACATATGT
AGAAGTTGCAATTGCAAACAAATATGTAAAAAATATTTTTTTTAATCTTTAGCTATAGAG
ACGCTTTACTCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgt
tggggtccgttttcaggaanggcaagccatccgacatgtcatcctcttcagaccaatcaa
atccatgaagagcatncctgggcataaaatccaacggaattgnggagntatcatgatgag
ctggccgagtcaatcgatacagtcaactgtctttgacctttggtactactctcttccgag
gatgatgtcgcacttattctatgctgn


CLOSE