Detailed Information [113922]

Strain Information
DGRC Number 113922
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6342 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP6342 / CyO, P{w-=UAS-lacZ.UW14}UW14
Original Number 6342
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
Balancer CyUW14
General Information NP_lines
Lethality lethal
Embryonic Expression weak uniform
Larval GFP uniform
Larval X-gal sg, uniform in epi, mt, fb, trachea, not in discs.
Adult GFP leg in young adult. ubiquitous internal.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np48335_0912
Flanking Sequence
gnngggnggngngnnngccagggggnnagggggtttngntttttngnnnggntaacnngg
gncatgaccttttttgtntacttncggtaagncttcggctatcgacgggaccaccttatg
ttatttcatcatgGTTGGGGTGGCAACCGAATGCTAATTAATTGAAAGCTTTCGCCCCAT
CTCTGTCGCAGCAAAAAAGCTTGCCgatcgaagaatacataagagagaaccgtcgccaaa
gaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctc
ttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtgga
gttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttact
actctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatc
agtctccactgaagccatcttattnngggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnaaaaaaaaaaaan

Library Name / Clone Name np / np67363_0309
Flanking Sequence
nnntttntgcgcacttattgcaagnctntcgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgACCCCAACCATCTTGCTCTTTCACACACCCACCCGTTTC
AAGGGGAAAGAAGGGGGTGGGAGAGTGATAAAGAGAGCACAAGGTCGGCGCTTTCTCAAT
TTCGAAACGCCAACGCCGGCCGGTATTTCGTTATTACAGCAAAGTGATCCTCTAGCTAGA
GGCTTTGCGTACTCGCANATTATTAAAAATAAAACTTTAAAAATAATTTCGTCTAATTAA
TATTANGAGTTAATTCAAACNCCACGGNCATGCTGAGGGNNGNTAATCAANAATAATNNN
GTTNNNTTANTCACNCTNNATNCTNTTGTAANANAANTNTTTCTNTTNNTANCACTTATA
ACAANCNNANNANTAGTGGATNTTTTTNGCNANNGNTNCCNNCTNNTNNNNNTNNATNAT
NNCNNNNNGNATNNNTTNTNNCACACACCCNNNNNTANANGNNANAANNNNGNNGNNNNN
NNNNNNNANAANAAANNNGNNNNNNNTTTNTNNTTNNNNNNCNNCNNNNNNNNNNNNNNT
TTNNTATTNNNNNNNNNNANNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE