Detailed Information [113971]

Strain Information
DGRC Number 113971
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP6542 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}NP6542 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 61B2
Map Viewer
Related Genes Mtch CG7042
Original Number 6542
Chromosome 3
Comments Sb[*] floating. 19Jun2013 M.W.
FlyBase Insertion: P{GawB}NP6542

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1722
General Information NP_lines
Embryonic Expression yalk nuc.
Larval GFP tr, epi
Larval X-gal sg, stripes in epi, midgut
Adult GFP abd
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46385_0912
Flanking Sequence
GGNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNCCTTCCNTCCACTTTTGGGGTTTTAAA
AAAAAANAAAANNNTTTTTTTGGGGGGGCNNNNNNNNAAAAACCCCCCNNGNNCNTNTTG
GGGNNNACCCCNCCCGNGGGNAAAGGCTTTTCGGGGGCNTTTTTCGGGNCNCGGGGGGAC
CCCNCCCCCCCNAANGGGGNNATATTTTNNAAAAAAAGNGGCCCCCGGGGGCGCCCCAAA
AAAANAGAAGACCTGGGGCCCCCNGAAAAAAAAAAGAAGGGNTTTTGGGNCGGGGGGGGG
GNGGGGCNCNAAAAAAAAAAAAAAGAGGGGGNNCCNCNNCGGGGNANAAAAANANCCCCN
CNTTTTNTAAAAAAAATATNTAAAAAAAAGGGGGGGNGCCNTTTTCGGGGGNNNTNNCCC
NCNACACNCAAAAANTATNAAAAAACNCCCCCCCCCCCCCNGNGGGGGGGGGGGGGGAGC
CNNNAGCAAAAACCACNNCCNACNANNAGNGAAANANNCNCCCNCCCCCCCNAAAAAAAC
NCCCCCANTANGCGNGGGGGGGGGGGGCCNCCCCCCCCCCCNCNCNNNGGGGGGGGGGGG
GGANNCNCCCCCCCNCCCCCNCAGAGNACNANNCCCCNCTNCCCGGCCNCCNNGCANCCA
CAANNNCCCCCNNNNNNAAAAANAAGNCNCNCCCCGCCCCNNCCGGCNNAAAAANNAAAC
NACANNANNANAGANAGGGAGGNGGGCNGGGNNGNGNAGGACNACCCNANANAAANNCNG
ACACCGCGNNCCCGCCCCCCcncncnnngccgaccncnanccncncncccgacccngccg
gccnggccccncncccncgccccccccncnccncaccnccagaccnnccaccnccnnngc
ncccnnccangcgcggcggcnaccacnccncacccnccnnaaccgccncgcnnnnncnnn
gcccccccccccngcggnccccgcccccccncncncancagaccccgccnnnaaacgacn
ncgccnnnnaanccgcnnccnnccgcccnnnccnncncccncncnccccccncccgcnca
agncnggacgngnaaanccgcgcnccncncggnccncncanncnccgnncncccccgncc
cnncgcccnccccccggnccccccccccccccgcaccaccccgccccgcccanncccccc
ccnccngnancanccccaccncaccncccgccagcccncngcncccnaacnnaccgcccn
gccnccccgtcnccncnnccccccccccccaanccccnnncncncncannccccgcnccg
cncccnccacncncccncnngcnccccgccnccgcncccncccgccaggngcgccgacnn
gnnngcaccccncgcccncgagannac

Library Name / Clone Name np / np66503_0309
Strand Plus
Insertion Point 165208
Chromosome Band 3L
Flanking Sequence
aatnttttctgcgcacttattgcaagtcntacgttaagtggatgtctcttgccgacggga
ccaccttatgttatttcatcatgGGCCAGAGAATGAGAAGATATCGATTAATCGATGACG
AATCGGTTCACGGCATTAGGCAACAACAAAGTACCCGGCCACATTGCTGTCAGAAGTATA
TTGTTTTGTAATAAAAAAATATAATTTTGCAACTTGCCAAAGCCTTGCAACCCTGTAAGA
GACGGCCAACGGTCTAATACTTTTTCTGTCTTTTGCACAGCAGTCCTCCAAATTAAAGGC
TACAGAGTTGGGCCCTCGGTATAAGCAGTCACCAGACCACCCAGTCACTCCACCCACCAC
GTAACTAGAATGGCCGGCTTTCCCGAGCACGCCCGCGCAGAGGATACGGAGGTTAATGTT
TGGATCCTCTAGCTGGGCNTTTTGGCCACTAGNGGATNTGGATCCTNTAGCTAGAGNNTN
TGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE