Detailed Information [113991]

Strain Information
DGRC Number 113991
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6586 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6586 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 78A1
Map Viewer
Related Genes fng CG10586
Original Number 6586
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6586

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2011
General Information NP_lines
Embryonic Expression pns subset? DV
Larval GFP cns, prob disc.
Larval X-gal fng-like pattern, multi-circles in the leg disc. proximal circle in the wing disc.
Adult GFP strong in tarsas and distal tibia. wing vein, antenna.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38745_0907
Strand Minus
Insertion Point 20867009
Chromosome Band 3L
Flanking Sequence
tgaattnagtgntacttcggtaagcttcggctatcgacgggaccccttatgttatttcat
catgCTGTGGCACAAGCTAAAGAGAGAGGATGAGAGCGAGCGCGATCGAAGAGAGAGCGC
CAGCTGCTCCCATTGGAGCAGCTAACGTTTCCAATTGGACCAGCTCAAAGGGAATTCTCT
CTCTCTCTTTCTCTCTCGCTACTCTCACCGCTTACTGGTCTTTCTGGTTTTTGTTTTGTT
TACGATTTTCGCTGGAAGAAGAGAAGAGTAGATCGCGCTACCACAATCAGTTGCTTTTCA
AGCTTGCCACAAGCAAGACGTCAGTGCGCGCGTGCTGCGATATCGAAATCGAAATAAACT
TAAAAGATATCGTAATTTCAGAAATCGAGCAGAATTCATACGATCCAAGAAANGANCCNG
CTNANNTNGGGATANANAANCCNACCCNGTGATCCAATTCGNNGNNGCTTAAATGTGCCC
GTNCANNCCNGTAACCCNATGANNACCCTGNCTGTGACTCTNNCCNCGAACCCNTTTAAT
GNNAATNCTNCANGCCNNGGANNTAGCCCNNNNCCCNCNTTTTTATTNNCCNTATGCNCT
NCCANTNCCCCTNNGGNTTTCCNGGCNTTCAAANNNANNNGNNTNCTNNNGTTNNCANNT
TNNNNCNNCCNNNNNNNTNNNNNNNNNNNCCNCTNNNNAATNNNNNNNNNNNNNNNNNNT
NCNNCCCNGNNNNNNNNNNNCCNNNANNTTNCCNNNNNCCNANNNNNNNNNNNNTTTNNC
CCTNNNTTTTNNCCNNNNNNnnntnnnnnnnntntnnnnntnnnnnnnnnnnnnnnnnnt
nnnnnccnncnnnt

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)


CLOSE