Detailed Information [114002]

Strain Information
DGRC Number 114002
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Mob2[NP6611] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}Mob2NP6611 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 68C13
Map Viewer
Related Genes CG11711 CG7394
Original Number 6611
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6611

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1868
General Information NP_lines
Embryonic Expression weak. segmental border (dorsal),
Larval GFP sg
Larval X-gal sg, gut, humeral disc,
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np01725_0711
Strand Minus
Insertion Point 11511920
Chromosome Band 3L
Flanking Sequence
gnnnngtttctttgtangantccaccgcggntatcgcnacctctcactnnngncttcgga
aagacctcggctatngacgggaccaccttttgttatttcatcatgCTGTGTAAGTTAGGC
AGCAAATGCAGTTCCTGTGTTCTTCGGTTTTCGTCTACCGCTCCATTCTATTTGATTACT
GATTTTATTTCTTCCTGGCCGAAAAAGAGCGTGATAATTACTCCCTGTGGNGAGATTTGA
TGGTCAGAGGAGTAGCTATTTCATGCGGGCTNGGGGTCACTTCATTGATAAGAACCACGT
AGCTGGAGGTCCTTACCATCGAGAATAACAAATTGGAATATATCTTTAATTCTTTATTTT
CTGTTTTCCTTTCAGGTGAGTGAAATATCTTGAGCATGAGCTTACCCAAATCCCAGGTAA
TTTGTTTAAGTCAATTAGAGCAGTCATTTTAACTGAGAAAAAAATTATAACATGCTTAGA
GTATTAAACGTATTAAATAAATGTTTAGCCCTTTAACAAAACTCTATGATGTTTTAGTTG
AACAGATTGTTATCAAGCCAATTAGTGTTCTTGGTAAAAGTACATAAGTGATGTGATGTT
TGCGTCAATTGTACGAAAATTGTGTTAGCCATTAAAATTTGGCCGAATTTATTTTCGTTT
ACCCTGNGATCGAAGAATTCNTTAGGAGAGNAACCGNCGCCCAAAGAACCCCATTTTTGG
TGGGGGGNCCCGTTTTTCAGGGAANGGGCAAGGCCATNCCCGACATGGTNATTCCCTNTT
TTNAGNACCCAATCCAAAATtccctgggaaggagcccttcccctggggccatnaaaaatc
ccaaccgggaaattggggg

Image Files
Embryo

e1 (->Large)

e2 (->Large)


CLOSE