Strain Information | |
---|---|
DGRC Number | 114009 |
Genotype with FlyBase Link | w[1118]; P{w[+mW.hs]=GawB}th[NP6632] / TM3, Sb[1] Ser[1] |
Genotype | w1118; P{w+mW.hs=GawB}thNP6632 / TM3, Sb1 Ser1 |
Break points/Insertion Site | 72D1 |
Map Viewer | |
Related Genes | th Mbs |
Original Number | 6632 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP6632 NP line. Received from the National Institute of Genetics. |
Balancer | TM3, Sb[1] Ser[1] |
Cluster id | 1929 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | mesoderm subset, pns subset |
Larval GFP | tracheal terminal, fusion(?). internal tissue. |
Larval X-gal | almost all PNS in the discs. sg, fb, CNS, |
Adult GFP | none |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np01945_0711 |
Strand | Plus |
Insertion Point | 15996210 |
Chromosome Band | 3L |
Flanking Sequence | antcttgggtgcanagccctttttttgtatacttcggtaagcttcggctatcgacgggac caccttatgttatttcatcatgTGCACCGCATTTCCACCTCTCTCTCACTCTCTCTCACT CTGTCTGTCTGTCTCTCCTCCATTGTGGCGAGGAGGAAGGAGCAGCTGGAACTTTCACAA AGTCCACATATCAAAAAAGGTAGATTATTATGCCTTCNANTTCCgatcgaagaatacata agagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagc catccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataa aatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaact gtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtc tcaatgttagaggcatatcagtctccactgagcatctttntttttgnggnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |