Detailed Information [114041]
Strain Information
DGRC Number 114041
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}jing[NP7009] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
w*; P{w+mW.hs=GawB}jingNP7009 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 42C1; 86C15
Map Viewer
Related Genes CG14698 CG15234 jing Rt1b{}1288
Original Number 7009
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7009

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 534 1436
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression may be early posterior gap like pattern (base on single bro at stg 10).
Larval GFP sg
Larval X-gal sg, CNS, mt
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np33055_0907
Strand Plus
Insertion Point 6797903
Chromosome Band 3R
Flanking Sequence
ttanacgtgcactgaatttangtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgCTCTGGCCCTTGCCAGCCGTTCTGGCTTTCGAAATCGAATC
GGCGGCAAGTGTTGGCCCACTTACAAGGCTCACACACACACACACACAGGGAAACCCAAA
GGATTCGACTGTTCGGCAAAGTCGAAAATGCGCGACCCGAGCGAAAGCCGAAGgatcgaa
gaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcagga
agggcaagccatccgacatgtcatnctcttcanaccaatcaaatccatgaagagcatccn
tgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcnata
cagaacaactgtctttgacctttggtactactctcttccgatgatgatgtcgcncttatt
ctatgctgtctcaatgttagaggcatatcagtctccactgagcatcttntttttggannt
ttnaantttccnnttccatanggggcagaataaatacaatgccattttatccatcaattg
aataactaaaacgaagcangcgtgctttctacatattgnctttcacatntgtacatatgt
agaagttgcaattgcaaacaaatatgtaaaaaatnttttttttaatctttanctttanan
accctttactcgatcgaaaaannatnannaanaaccnncnncaaaaaacccnttntngtn
ggggtccgnnnnangaagggnanncnnncnaangnnnnncntttnnnnnnaatnnnntnn
tgaannncntnctggncatnaaatccangnnnttnnggnnntnnannannanntgncnnn
aaancnnnannnannggnttnnncntngnnnnacnnnttncnnngnnangnnnnntnntt
nnnn

Library Name / Clone Name np / np62943_0309
Strand Plus
Insertion Point 1674090
Chromosome Band 2R
Flanking Sequence
tttactcgcacttattgcagnctacgttaagtggatgtctcttgccgacgggaccacctt
atgttatttcatcatgGCTTAGCGTTTATCGACCCGTTNTGTGTTCTCTTATTCTGTTGC
GCTCTTCTCCTTCTCTNGTTCGCTCTCTTGAAACAATAATTTCCCTATTTCTCGTGTAAA
ATGAATACATGTTTTTTACAGNTATTCAAAATTAAAATATTTTGTATCACAAACACGGNG
NAAATCGATCATTTTAAGATCAATTNTANAAATGNTNTGCGCGCATGTNGTTGAATTTAA
TTTCGCAGCTGAATGCCTTGTGAGTNCTCTTATTCTCTNTAGCTCTNNTNCTTNTNTTGN
TNGGTCTNTTGCAACCATATNTNCCTTATNTCTCGTGTTAAATGAATANATGTNCNTTTA
CAGTATCTCTAAATTAAAATAANTTCTNTCACATCACTCGAGNAAATCGATTTTTTAAAG
ATTNATTNCNAAATNGTTGCTTGCGCGCCTCTTATTGAATTTAGTTTCATAGCTGCTTGC
CTTTTACTGCGGGTTGNTTTGGGAAATTTATCAGCTGTTAGCCGCGCTGNTAGAGGTAAC
AGCGCTTGCGACGGACATTCTNTAACACAGNCGGGAAATAAACATCCAAGAATAATTNGN
GTGGNCTTCCAACACTGGCAGGCANNTAAACAATCAAAGAAAAAAGATTTNAAAAGGNGN
GNNAAAAANGACAAAAGNNTNNCCNAANCNTNTTTNANGGGCNATGCAANGNAATTGCCN
GNNNGGNGAATNAAAATANCaggcaananncnnnnncnaacnaannaannnantnccctt
cctttgnccgnnnnnaaangnggggnngnncccnngnnnnnttnncnnannngggncgnn
nanncccnnnnnntnnnnnnnnnncccnncnanaaanancnnnnnnnnnannnnccctnn
nntttnnnngggg

CLOSE