Detailed Information [114042]
 

Strain Information
DGRC Number 114042
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}esg[NP7011] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}esgNP7011 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 7011
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7011

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression weak. not indicative of esg.
Larval GFP esg-like
Larval X-gal sg, fb, foregut,
Adult GFP weak internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33075_0907
Strand Minus
Insertion Point 15312856
Chromosome Band 2L
Flanking Sequence
attttnggcgtgaactnaattttgtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGGTATGGGTATAGCCGCCCAAGCTCGGATAACCGGGCAT
CTGGGGATAGGGCAGGAAACGGTGCTGCCGCACGCCGATTGGTCTATGGATGATTTCCGA
TCGAANAATACATAANAGAGAACCGTGCGCCAAAGATNNCATTATTGTTGGGGTCCGTTT
NCAGGAAGGGCAAGCCATCCACACATGTCATCCTCTTCANACCAATCAAATCCATGAAGA
GCATNCCTGGGCATAAAATNCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCA
ATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCA
CTTATTCTATGCTGTCTCAATGTTAGANGCATATNANGCTCCACTGANCATCNNNTTTTN
GGNNNANCCNAANNNNATNAAANTNTTNNNNTNTNNNNNNATNAGNGNNACATTTGGNNN
AAAATNNNACCGGNTTNNCTCAANCCNAAAGNGGNCANNTTTTNNTTTCCAACNGNNNNA
NACCCCNNNNGGNCNANGNNTTTNNNNAANNNNNNTTNTTTTNNNNNGGGNAAANAANNG
GGGNNGGNNNCNNCTNNNNAAAAANNCNAACCCCNTCCCNNNNNNAANAAANNTTTNTTT
TNNNCCCAAANNNNNNANNNGNNCNANNNTNGNAAAANNNNNNNNNNNNNNNNNNNNNNN
NTTNAAANNNNNAANNNNNNnncnnnnnnnnnnnnnaanntttttnnnnnnccccccnnn
nccnnaaannnnngggnaannnnnnnnnnnnccccnnnnnnnnttttnnnnnnnnnnnnn
nnnnnnnnnnnnnncccccnnnnnn

CLOSE