Detailed Information [114073]
 

Strain Information
DGRC Number 114073
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP7095 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP7095 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site ---
Map Viewer
Related Genes CG17702 CG40209 CG40214
Original Number 7095
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 2075
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression elongated cells in pns? (not PNS neuron, TU) or epi.
Larval GFP ubiquitous
Larval X-gal uni epi, tr, gut
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33955_0907
Strand Plus
Insertion Point 1684868
Chromosome Band U
Flanking Sequence
antcttggggaaaaaacccattttttngnatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgGTTCGCTTTAAAATGCCCACGCTCTCCACAGTTATAA
CAAACTACGTCTTTCCTCTTCTTTGCGCTCGGCCGAGCTTCTCTCGCCGGCGCCTGTGGC
TTATGTACTGCAGTAAATGCCTTTGCGCTCTCCGTTTGTTTTTCTCTCTGCTGCTCCGCT
CCTCCCCTTCTCGTGTCTTCCTCgatcgaagaatacataagagagaaccgtcgccaaaga
acccattatngttgnggnccganttcangaagggcaagccatncgacatgncatcctntt
cagaccaatcaaatccatgaagagcatcccngngcataaantccancggantcgtggagt
tatcatgatgagctgccgagtcaatcgatacagcnaactgcnttngacctttgttactac
tctcttncgatgangatgtcgcacttattctatgctgtctcaangtgagaggcatatcag
tctacactgaaggcatntnnttntggggggnnnanccttttaaaaaaaccangnngcgaa
anacttnncactnnaanaagntnngagganannnnnnannnaanngggccnnanaaaccc
nttnnngnnngngncccnnnnnnaggangggcnnnccntnccacntgnnannnnnntnnn
acaannaaaannnannaaagnnnncnnggcannaaanncnanngnantgggnnnntnnan
gannngnnncnannnaannnnncannnaanngnnnnnnnccnnngnnnnacncnnnncnn
anannagnnnnnntantnnannnnnnnnaaggnngngcnnnnannnnncntgannannnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
a

Library Name / Clone Name np / np63223_0309
Flanking Sequence
CCCCCGGGGGGGGGNNNNNNNNNNNGNGNNNGGGGGGNNNNNNGNGGNNNNGGNCCCCCC
CCCGGGGGGGGNNNNNNGGGNCCCCCNNNNCCCCCCCNCCCNGNNNNGGGNGGGGNNNGG
NNNNNNCNGGGNCGGGNGGGGGNNGCNNNCCGGNNGGNCNNNNNNNNNNGGNNGGGGGNN
NNGNCCCCCCCCCCGGGGGGGNGNGGNNCCCGNGGNNNNCCCCNNNGNNNNNGNNNNGNN
GNNNGGNGNNGNGNNGGGGNGGGGNGNNCCNNGNNNNGGGNCNGNGGNGNNGNGGNGGGC
GGCGNNGNNNNNNCCNNNNNGNNGNGNNNNNNNCGGNNNNNNNNNNNNGNGGNNCNCCGN
NNNNGCGCNCNNNNNCCNNCNNCCCCNNNNNNNNNNNNNNNNNNCCNNNCNNCNCGNCCC
CCCGNNNNNNGGNCNNCNGCNGNNCNCCNNNNGNNGCGGCNGNNCCCCCNNNNCCNNGNG
NNGNNNNNGGNNGCGCGGNGCCNCNCCNCCCCCCCCCCCCCCCCCCCGGCCCCCGNGCNC
NNGGGGGGGGGGGGGGCCCCCCCCCCCNCCNNNGCCCCCCCNNGGNGGGNCCCCCCCCCC
CCCCCCCGGGGGCCCCCCCCCCCCNGGGNCGGNCGGGGGNCCCCCCCCCCCCCCCCCCCC
CCCCCCCCGGNGGGGGGNCCCNGGNCCCCCNNGNNCGCNCCCCCCCGGGGGGGNNCCCNN
NNCCCCCCGNGCCCCCCCCCCNCGGGGCCCCCNNNNCCCCCGGGGGGGGGGCCGNNNNNC
CGGGGNNCCCNNCNCNCNCCccggggncccggngcccggngggnnngngngggnngnnng
ggggcccccccccnggnccccccgccnccgnnggnccccccccccccggggggcgggnnn
ccgggcccccnnccccccccgccngggccccggggcccccgnggcccccgcccccccccg
gnnggnnngcccncnnnncccccccccgggggggggggccccccccccccccccccccnn
nnnncccccccccgggncccccccccccccgnggggggnnnccnccgncccccncccccc
gggnncgngnncccngggggggggggnnnnnngggggcccnccccnnccccccccccccc
ggggggggggggnncccccccncggnngggccccccngggggnccncccccccccnccgg
ggccccccccccgggggggcccccccncngggggccccccccccggggggggggccccgg
gggnnnnnccccccccccnccccggggggnnncnnnnnnnnngggggggncccccccccc
ccccccccccccnnnnnnnnnnnnnncnnncnnncggggggggggggccccngnggnccc
cccnccgggggggnnnggggggggggggggggnccccccccccccccccccccccccccc
cccnnnnncnnncncgcnnggggngcccg

CLOSE