Detailed Information [114127]

Strain Information
DGRC Number 114127
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NFAT[NP7183] / FM7c
Genotype y* w* P{w+mW.hs=GawB}NFATNP7183 / FM7c
Break points/Insertion Site 12A9
Map Viewer
Related Genes NFAT CG12176 CG2691
Original Number 7183
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7183

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 326
General Information NP_lines
Embryonic Expression sg, gut, hg, anal pad
Larval X-gal sg, gut, fb, mt, cns
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np18695_0807
Strand Minus
Insertion Point 13372744
Chromosome Band X
Flanking Sequence
attttttcgtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTCCGGGCGAAAAGAACGAATCGAATCGAATGATGCTGA
ATGAAGACGTGGTGAGCGAGAGAGCGAGCAGAGGGGCATGTATTAAAGAGGAGGATGAGG
AGCAGAGCTGCCCAAGAGAGAGAGCAAGAGCCGACTGAGATGGAGCAACAAGTGTACGCG
TGGCCGAATGACGACAACGGGTTTAATTGATTTCGATGTGTGTGTGAGCAAGCAgatcga
agaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcagg
aagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatcc
ctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgat
acagtcaactgtctttgaccttttgttactactctcttccgatgatgatgtcgcacttat
tctatgctgtctcaatgttagaggcatatcagtctccactgagcatnnnnttnnnnnggg
gggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE