Detailed Information [114204]
Strain Information
DGRC Number 114204
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP7286 / FM7c
y* w* P{w+mW.hs=GawB}NP7286 / FM7c
Break points/Insertion Site 14A8; -; 14A9
Map Viewer
Related Genes CG8958 CG9216
Original Number 7286
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7286

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 381
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression muscle subset
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np53185_0227
Strand Minus
Insertion Point 15822644
Chromosome Band X
Flanking Sequence
antttttggggnaaaaaaacccccaatttttttgctncggtaanactcccggctatcgac
gggaccaccttatgttatttcatcatgGACCAACACGGTGGTGAAGGTGGGGGTGCTGGT
GCCGAAGTGTGCGTGTGCACTTGTTTGTTGTTGGTTCACTGAGGCCCGTTCGCGCGTCAA
TTCAGTCTCAGTTACTAAACCGATTTCAAGAACTACGGACGCTTCGNTCTTTNNTTGCTA
AGTGGCGTGTGCTACAATTAAGTAACGGGCAGAGACATTTCACAACAACAACAAAAAATA
GGAAAATAGAATACAACAAGAAATACAAAACCAAAAACCATCAAAATCCCAATAAAACCA
AACCACATTAAACAAGAAAATAATAAATAGACATCCGAGCACATATACCCACGCAAAAGT
AAAACAATAGCATACTAGTTCGTACAACTAGGGTATTTTATACATAACTCGCTAAATCCT
TCGTTTAATACAACGACCACCAGGAGGAAACAACCAAAAACTACAGTAAATCGGAAACAA
GAAATAACCATCAGCAAACTGCACCGGTACTTAAAAAAAAAAACAAAATAAANGTTTAAA
TTNCAATTTTTTTATNTTTTTTTGGTTAAAAAAAAAGGCAATATATTGGGGNNCTTNGGG
GGGGCNNGGGCCAAAANTTGAAAAAGNCAGGGAANTTNTCCCCCNNTACNNATNCNTTTT
TTNTNGCCCCNCANAAAAAAAACAAAAANAATTGNNTNNGNATTTTAAAAAAAAAAAANN
TTCCNNTAAAAAAAAAAAAAnaaaaanggggggggggggnctnntgtttttttccntttt
gccngngggggnnntaaananncccctttttttnnttntccaaanntntgggngncacan
tnaaananngggggnttttnanaccccaaaggggacaaatttnttttntaaaaaaaatat
tnggtgagggaanangannncncctcngnngaaannnt

CLOSE