Detailed Information [114218]
 

Strain Information
DGRC Number 114218
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP7313 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP7313 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 7313
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7313

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression pns, ventral epi stripe including wing and leg
Larval GFP sg
Larval X-gal disk, gut, mt
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np06635_0711
Strand Plus
Insertion Point 15311844
Chromosome Band 2L
Flanking Sequence
annntttggggtgcactgaaatttatttgtatacttcggtaagcttcggctatcgacggg
accaccttntgttatttcatcatgCTCTGGGCGGAACNCCCGAGCAGAGCGTTCTCTTTT
GGCTGTTTGAGGNAATGAGCCGAGNGCCGCGTGCAGGGGCAGNATAAAAAGGCCGCACCA
CCGCCAAACTCGCTCAGTTATTCCCAGACTCTAACCGATTCACATANCCATCNCTCCCAA
CGCAATATACCCGAAATATAACCGANATTCAATCGCTTTGCTTAACGGAACACGCGTTNG
GTATCTGTGCATCGANcgaagaatacataagagagaaccgncgccaaagaacccattatt
ggaggggtccgtnttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatc
aaatccatgaagagcatccctggggcataaaaatccaacggaattggggagntantcang
atgagcctgccgagncaatcgntacagggcaacngtcntttgaccattgntactactctc
tnncgnngangatgnccccccttattgnatgctgcctcaatgtagaggcatannagnctc
cacngagccatttnntntnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaanng
ggnnnnncannngnnnnnnnnccccnnnnnaaaaannnnnncccnnnnannnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnn
nnnnnaaancnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnaaannnncnnannngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna

Image Files
Disc

d1 (->Large)
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)

CLOSE