Detailed Information [114229]

Strain Information
DGRC Number 114229
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Uba1[NP7338] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}Uba1NP7338 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 46A3
Map Viewer
Related Genes Uba1 Mmp2 CG30002
Original Number 7338
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7338

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 637
General Information NP_lines
Lethality lethal
Embryonic Expression muscle subset,
Larval GFP no gfp larva
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np06795_0711
Strand Minus
Insertion Point 4753539
Chromosome Band 2R
Flanking Sequence
GGGNNAGTGNNTGTAAGTTNNNTTGGNNGANTAACCGGGNGTTCAATNANCCNTTCACTT
GGGNCTNNCGGTAAGACTNCGGCTATCGACGGGNACCACCTTTTNTTATTTCATCATGGT
GCGTATCGTCGTCTACCTCTGACACATGCGGCGTTAATGNTGCGGCGAAGCGAGCCGAAA
AGCAGAAACTGAAACAGAGCCAAGGAAGCGGCGACGACGTTAGTACCTCGTCAGCAGTGG
AAAAGGANGGAAGCAAGCGGCCGGAGAAGCGCAATTACCTGAACACNACCACAATAGAAT
CGCAAGAAGCCTCCTCCAGTGCATCCGCCACTAGCAACAGCAACAACAACGTCAGCTCCA
GCAACAATAACAGTAATAACAGCACTAATAACCGACAACTGGAAGGAAGCAGCAACATGG
CTGGAAACAGTGCCGCCGCCGGCGGAGATATCGATGAATCGCTGTACTCGCGCCAATTGT
ACGTCCTGGGTCACGATGCGATGCGTCGGATGGCCAATTCGGATATCCTTCTGTCGGGAC
TTGGAGGACTCGGCCTGGAGATAGCCAAGAATGTGATTCTGGGCGGCGTGAAATCGATCG
AAGAATACATAAGAGAGAACCGNCGCCAAAGAACCCATTATTGGTGGGGTCCGTTTTCAG
GAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATC
CCTGGGCATAAAAATCCAACGGAATTGGGGAGNTATCATGATGAGCTGNCGAGTCAATCG
ATACAGNCAACTGGCTTTGAcctttggtactactctcttccgatgatganggcgcactta
ttctatgctggctcaatggtagaggcatatnagnctcactngcnnnnnnnnnnnnggggg
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE