Detailed Information [114270]
 

Strain Information
DGRC Number 114270
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP7399 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP7399 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 7399
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7399

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns midline+ pns (ch), oencyte, wing, haltere
Larval X-gal sg, dots on gut, out ring of pouch, ubidisc
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np40025_0907
Strand Plus
Insertion Point 15311825
Chromosome Band 2L
Flanking Sequence
gaanngttttttgnnnggatntnttgggggcaaaaacccntatttgtatacttncggtaa
gacttcggctatcgacgggnaccaccttatgttatttcatcatgACCTGAATGAACATGT
ATACTCTCGGCGGAACGCCCGAGAGAGCGTTCTCTTTTGGCAGCTTCGTGTAATGAGCCG
AGTGCCGAGTGCAGGGGCAGTATAAAAAGGCCGCACCACCGCCAAACTCGCTCAGTTATT
CCCAGACTCTAACCGATTCACATAACCATCTCTCCCAACGCAATATACCCGAAATATAAC
CGATATTCAATCGCTTTGCTTAACGGAACACGCGTTTGGTATCTGTGCATCgatcgaaga
atacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaag
ggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctg
ggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgataca
gtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattcta
tgctgtctcaatgttagaggcatatcagtctccactgagntnnnnnnnnnnggggnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

e2 (->Large)

CLOSE