Detailed Information [140002]
Strain Information
DGRC Number 140002
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL00003 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL00003 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 30E1
Related Genes snoRNA:Z5 (CR31877), Bka (CG4539)
Received Date 19 October 2007
Original Number LL00003
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:9894925(+)
Cytological Band: 30E1
Gene Symbol-1: snoRNA:Z5
CG Number-1: CR31877
FlyBase ID-1: FBgn0025881
Insertion Type-1: CDS
Gene Symbol-2: Bka
CG Number-2: CG4539
FlyBase ID-2: FBgn0010520
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Plus
Insertion Point 9894925
Chromosome Band 2L
Flanking Sequence
NNNNNNNNNNNGNNNGCGNNNNTTTACGCAGACTATCTTTCTAGGGTTAAGCACTTTAAT
TCACTTGATGTAAAACTATTTACGAAGAGCACACAACTTACCATTTCGAATTAACCATTG
TGGGAACACTAGAACTAGCTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAATTCG
CCCTATAGTGAGTCGTATTACGTTATCTAGTTAGGCGCGCCTGTGGGACGGAAGAACAGA
TGAATTAGATATCTATAACAAGAAAATATATATATAATAAGTTATCACGTAAGTAGAACA
TGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGATAATCA
TGCGTCA
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE