Detailed Information [140018]
Strain Information
DGRC Number 140018
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL00073 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL00073 bw1 / CyO, S* bw1
Break points/Insertion Site 58B1
Related Genes CG13499
Received Date 19 October 2007
Original Number LL00073
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:17902263(-)
Cytological Band: 58B1
Gene Symbol-1: CG13499
CG Number-1: CG13499
FlyBase ID-1: FBgn0034680
Insertion Type-1: CDS
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Minus
Insertion Point 17902263
Chromosome Band 2R
Flanking Sequence
NNNNNNNNNNNNNGNNTNANNTNNACNCNGNCTATCTTTCTAGGGTTAAAGGCACTTTTT
AGTAGCTTATACTCTGCTATTAGCGAAATTTATATTTCAATCATTGGATTCGAATTAACC
ATTGTGGGAACACTAGAACTAGCTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAA
TTCGCCCTATAGTGAGTCGTATTACGTTATCTAGTTAGGCGCGCCTGTGGGACGGAAGAA
CAGATGAATTAGATATCTATAACAAGAAAATATATATATAATAAGTTATCACGTAAGTAG
AACATGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGATA
ATCATGCGTCANTT
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE