Detailed Information [140019]
Strain Information
DGRC Number 140019
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL00077 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM3, Sb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL00077 P{y+t7.7 ry+t7.2=Car20y}96E / TM3, Sb1
Break points/Insertion Site 92F3
Related Genes Pi3K92E (CG4141)
Received Date 19 October 2007
Original Number LL00077
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: ~3R:16459431(+)
Cytological Band: 92F3
Gene Symbol-1: Pi3K92E
CG Number-1: CG4141
FlyBase ID-1: FBgn0015279
Insertion Type-1: 5' UTR
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Plus
Insertion Point 16459431
Chromosome Band 3R
Flanking Sequence
ANNNNNNNNGCATGCGTGAGTTAATCTTAANAGTCACGTCTAAGATAATCTTGCGTCATT
TTCTCTCTGCGAATAGATATAAAGGTGGCGCCGGGTTACTTGAAAGAAAACCTATGGCGA
TATATGTACCGATAATTGTTTTGGTGTCGAATTAACCATTGTGGGAACACTAGAACTAGC
TAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAATTCGCCCTATAGTGAGTCGTATT
ACGTTATCTAGTTAGGCGCGCCTGTGGGACGGAAGAACAGATGAATTAGATATCTATAAC
AAGAAAATATATATATAATAAGTTATCACGTAAGTAGAACATGAAATAACAATATAATTA
TCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGATAATCATGCGTCA
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE