Detailed Information [140023]
Strain Information
DGRC Number 140023
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL00100 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM3, Sb[1]
Genotype y* w*; PBac{SAstopDsRed}LL00100 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM3, Sb1
Break points/Insertion Site 75d8
Related Genes Nufip (CG4076), Aut1 (CG6877)
Received Date 19 October 2007
Original Number LL00100
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3L:18741539(-)
Cytological Band: 75d8
Gene Symbol-1: Nufip
CG Number-1: CG4076
FlyBase ID-1: FBgn0036812
Insertion Type-1: Putative Promoter
Gene Symbol-2: Aut1
CG Number-2: CG6877
FlyBase ID-2: FBgn0036813
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Minus
Insertion Point 18741539
Chromosome Band 3L
Flanking Sequence 
GAATGCATGCGTCATTTTACGCAGACTATCTTTCTAGGGTTAATAAAAATAAATCTTACC
TTAAGAAAGACATTCCTTTTAATATGTAGTACGCATGTTGGTATATTCGAATTAACCATT
GTGGGAACACTAGAACTAGCTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAATTC
GCCCTATAGTGAGTCGTATTACGTTATCTAGTTAGGCGCGCCTGTGGGACGGAAGAACAG
ATGAATTAGATATCTATAACAAGAAAATATATATATAATAAGTTATCACGTAAGTAGAAC
ATGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGATAATC
ATGCGTCA
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE