Detailed Information [140026]
Strain Information
DGRC Number 140026
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL00104 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL00104 bw1 / CyO, S* bw1
Break points/Insertion Site 50c18
Related Genes Cp1 (CG6692)
Received Date 19 October 2007
Original Number LL00104
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: ~2R:9848200(+)
Cytological Band: 50c18
Gene Symbol-1: Cp1
CG Number-1: CG6692
FlyBase ID-1: FBgn0013770
Insertion Type-1: 5' UTR
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Plus
Insertion Point 9848200
Chromosome Band 2R
Flanking Sequence
GTCAATTATTTTCAAAACTATCTTTCAAGGATAAAACAATTTCTGCTGGTTTTCATCAAA
CAACNAATGGTCTTTGGGACTGGATNATCCAGAGCGAATTGTTAAATACAATCGGTTGAC
TTGCACATTAGTTGTTGTTTCANCCATTTAAAAAGAGTGCAACAACAGTGATAAATCAGT
GAATTTACTGCATACCTTGCGACGCAATTCCGAGTGGTAAGCAATATATGACAAATTAAC
CATTGTGGGAACACTAGAACTAGCTAGTTCTTGAGCGGCCGCCACCGCGGTGGAGCTCCN
ATTCGCCCTATAGTGAGTCGTATTACGTTATCTAATTAGGCGCTCCTGTGGTACGGAAGA
ACAGATGAATTAGATATCTATANN
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE