Detailed Information [140142]
 

Strain Information
DGRC Number 140142
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL00722 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL00722 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 25C3
Related Genes CG14040, eIF-3p40 (CG9124)
Received Date 19 October 2007
Original Number LL00722
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:5053324(+)
Cytological Band: 25C3
Gene Symbol-1: CG14040
CG Number-1: CG14040
FlyBase ID-1: FBgn0031676
Insertion Type-1: CDS
Gene Symbol-2: eIF-3p40
CG Number-2: CG9124
FlyBase ID-2: FBgn0022023
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 5053324
Chromosome Band 2L
Flanking Sequence 
ctatctttctagggttaaATTGATAGTCTCCACCTGTCTGTATTGCCGATAGTGAGTAGG
AGTGGAGGCGCTCCTTTGTCTCGCTATTAAACCGCGATTTCATTCACAGCAACAACCTAC
GCTCCCTGGTGCGCGATGTTCACAAGGATCGGAATGTATTGGGCTTGTACATGGTGCCCG
CCTTTCTCTACTGCCTGTANNACAATTTGG
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE