Detailed Information [140169]
 

Strain Information
DGRC Number 140169
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL00822 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL00822 bw1 / CyO, S* bw1
Break points/Insertion Site 51D7
Related Genes CG10265, CG7639
Received Date 19 October 2007
Original Number LL00822
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:10880122(+)
Cytological Band: 51D7
Gene Symbol-1: CG10265
CG Number-1: CG10265
FlyBase ID-1: FBgn0033990
Insertion Type-1: CDS
Gene Symbol-2: CG7639
CG Number-2: CG7639
FlyBase ID-2: FBgn0033989
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 10880122
Chromosome Band 2R
Flanking Sequence 
ttnacncanactatctttctaNGNTTNTGGCACCATCCTTACACNNNNNNNNNNNNNNNN
TTTNTTACNNNGGNGNNCNNTNNNNNNNAGNNNNNTTNNNNTGATGTCCAAGGTCTCTTG
ATTTTTGGTTGGATTTAGCTCAGTCGTGGCATTNTCCCNNAAAANGAGGCTCGCTTCACC
TCCACACCGCATGCTCTGAGTGTGTTTAGGATTTTCTGGGTGCCATCCAATGGAGGAGTT
GATTTGCTTGTTATGGTAGGAACTGGTTTCTCGGGCGTCTTGGGAGGTTCTGGNACTTCA
GATATCCTTGAAGANACTGGTNCAATAAGCTTCCAATTCACCTTTTGTGGGAACCTANAA
CTAGCTANTTCTATAGCGGCCGCTATCNTAAAAATTTTCTCCAATTCCCCCTAAAGCGAG
TCTTTTTTTTTTTTCTAGNNNGCATCTCCTTGTTCGACTGAATAACCCATGAATTAAATG
TCCACTCA
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE