Strain Information | |
---|---|
DGRC Number | 140235 |
Genotype with FlyBase Link | y[*] w[*]; PBac{SAstopDsRed}LL01035 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1] |
Genotype | y* w*; PBac{SAstopDsRed}LL01035 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1 |
Break points/Insertion Site | 66D6 |
Related Genes | foi (CG6817), ergic53 (CG6822) |
Received Date | 19 October 2007 |
Original Number | LL01035 |
Chromosome | 3 |
Original Source | Liqun Luo, Stanford University |
Original Comments | Location: 3L:8526903(+) Cytological Band: 66D6 Gene Symbol-1: foi CG Number-1: CG6817 FlyBase ID-1: FBgn0024236 Insertion Type-1: 3' UTR Gene Symbol-2: ergic53 CG Number-2: CG6822 FlyBase ID-2: FBgn0035909 Insertion Type-2: Putative Promoter. Location coordinates are based on the Drosophila Genome release 5.0. IMPORTANT NOTES: Oren Schuldiner (Weizmann Institute of Science) |
General Information | MARCM |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Reference | Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L. piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning. Dev Cell (2008) 14(2) 227-38 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
|
Stock Request |
Library & Clone Information |
---|
Strand | Plus |
Insertion Point | 8526903 |
Chromosome Band | 3L |
Flanking Sequence | tttacgcagactatctttctagggttaaCGACTTGAACGCATATTATTTCCYCTTTCGGG AAATGTACACAAAACCCATTTAAGCTTAATTTATTATCGTATTTGTAATAAATTGAAAAG ATTATTATATTGCACCATCATGCATAATTTAGATTTTCGCTACACTGTAGCGCCTTCGTT TAATTATAATTTTGTAATAAATCAAGCTAAAACAAAGACTTTGATTTTGTTTTAATcgaa ttaaccattgtgggaacactagaac |
Sequence Comment | Location coordinates are based on the Drosophila Genome release 5.0. |