Detailed Information [140316]
 

Strain Information
DGRC Number 140316
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL01306 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL01306 bw1 / CyO, S* bw1
Break points/Insertion Site 53B5
Related Genes CG30096, CG4282
Received Date 19 October 2007
Original Number LL01306
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:12209613(+)
Cytological Band: 53B5
Gene Symbol-1: CG30096
CG Number-1: CG30096
FlyBase ID-1: FBgn0050096
Insertion Type-1: 5' UTR
Gene Symbol-2: CG4282
CG Number-2: CG4282
FlyBase ID-2: FBgn0034114
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 12209613
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggttaaTGCACAACGATTAGAGTGACCAAAATCCGATT
TGATATCGCCTATCGTTATCGGCAGTGTTGGTAAAGGCCCCGCAGCTTGCACTGCWATTG
TGAACTGCAAAACAGCTGGCGTTTTGATTGCACTGCGGCTTTAAACAAATTAGTAAAGTA
AATAAAAACTGCATTTTACGCCCAAACACTTAAATGGCTTTTTATTATCTGTAACAAAGT
CTACAAATCGCAATGGGTAAGCCAGCGGCAGTAAAGGAATCGGCTGGACCGCATcgaatt
aaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE