Detailed Information [140317]
 

Strain Information
DGRC Number 140317
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL01310 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL01310 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 33E4
Related Genes CG5446, CG6388
Received Date 19 October 2007
Original Number LL01310
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:12427776(+)
Cytological Band: 33E4
Gene Symbol-1: CG5446
CG Number-1: CG5446
FlyBase ID-1: FBgn0032429
Insertion Type-1: Putative Promoter
Gene Symbol-2: CG6388
CG Number-2: CG6388
FlyBase ID-2: FBgn0032430
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 12427776
Chromosome Band 2L
Flanking Sequence 
tttacgcagactatctttctagggttaaTGTCAATTTATTATTTTAATTTATTTTAATCT
TTAAATAATTCAAATAAATATTAAGAACCATTTTTWTTCAACATCATTTTATGGGATGTA
TTATTAATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGATAATCATGCGTC
CCGTAAAAGATAATCATGCGTCACKTWYAAGRTACTMAAGCAYACKRCAAAAKRTTWWYT
TGSSC
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE