Detailed Information [140342]
 

Strain Information
DGRC Number 140342
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL01392 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL01392 bw1 / CyO, S* bw1
Break points/Insertion Site 54C1
Related Genes CG4866, CG11419
Received Date 19 October 2007
Original Number LL01392
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:13405962(+)
Cytological Band: 54C1
Gene Symbol-1: CG4866
CG Number-1: CG4866
FlyBase ID-1: FBgn0034232
Insertion Type-1: Intron
Gene Symbol-2: CG11419
CG Number-2: CG11419
FlyBase ID-2: FBgn0034231
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2023-05-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 13405962
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggttaaATCCCCATTAAATTTGTTAATTTTTAGGTATA
ACAAGTTGTCCAGGGAGATACGGGAACTGGCAGAGAGGATAGCTAAGCTGGATGCTTCAG
AACCTTTCAAGACGGAGGCCACCACCATGCTCCTAAACAAGCTGCACGCCATGGGAGTTT
CCAATGATCAGCTTACTTTGGAAACGGCGGCCAAGATATCTGCCAGCCACTTTTGCCGAC
GTCGTCTACCCGTGATCATGGTGAAACGTGAGTACCATCCCTTAATAAGCACTTCATTTT
CATATAACCATTTTCCGTTGGCAGTTcgaattaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE