Detailed Information [140351]
 

Strain Information
DGRC Number 140351
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] PBac{SAstopDsRed}LL01414 / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 PBac{SAstopDsRed}LL01414 / CyO, S* bw1
Break points/Insertion Site 60A13
Related Genes CG3803, thoc5 (CG2980)
Received Date 19 October 2007
Original Number LL01414
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:19841340(+)
Cytological Band: 60A13
Gene Symbol-1: CG3803
CG Number-1: CG3803
FlyBase ID-1: FBgn0034938
Insertion Type-1: Intron
Gene Symbol-2: thoc5
CG Number-2: CG2980
FlyBase ID-2: FBgn0034939
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 19841340
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggttaaTGCAACCTTTATCGCTGTTTGCGCAATCGTCT
GGTGAAGTCGGGGGCCGGGTACTACTAGCTTTATGAGATTGGTTCTCTTCTGGAGCAATC
GCAGCATTGTGTTATTTCAAGTTTGGAGAGATTAACTTAAGCTTACAGCAAATATTAAAG
GATATATTTTGTTTTTTAACTATATTTACAAAGCCGCTACCAAGTGTGACCGCAGCAGTG
GGGTATGCGCATATACTAAAATCATTTTGAAAAGTACCGGCGAATGTTATcgaattaacc
attgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE