Detailed Information [140361]
 

Strain Information
DGRC Number 140361
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL01436 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL01436 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 34A10
Related Genes CG16812, Ski6 (CG15481)
Received Date 19 October 2007
Original Number LL01436
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:13222979(-)
Cytological Band: 34A10
Gene Symbol-1: CG16812
CG Number-1: CG16812
FlyBase ID-1: FBgn0032488
Insertion Type-1: CDS
Gene Symbol-2: Ski6
CG Number-2: CG15481
FlyBase ID-2: FBgn0032487
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 13222979
Chromosome Band 2L
Flanking Sequence 
tttacgcagactatctttctagggttaaGATCCAACAGCATGTCGTCCTGGATGCGGTTC
TCCACGAAGACGTGGGCATAGCCGGCAGCCGCAGGAGATGGGATGCCGGCCGCATTGAAG
AATTTTACCCAGCGTGCTGTAATTTTCGGTGGTGAGTTCATTATTTTTAAAGTGTGTGAT
ATTTTTTAGGTCTTTATTTTTGTTTCGCACCCGGAAGCGTCTGTTCAGTTTGTTTCGTTT
TCACGATGTTATAAACCCACCTGCGCTTGACTTGGACATTGTGCGTATTTCTGGTGCTGG
CAAGCACAGATTCTTACACGATTCAGCTACTATTTATTTATTTTATTCCCATAAATTCCG
TTTTTTGCACTcgaattaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE