Detailed Information [140405]
 

Strain Information
DGRC Number 140405
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL01554 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL01554 bw1 / CyO, S* bw1
Break points/Insertion Site 58D3
Related Genes pgc (CR32885), T3dh (CG3425)
Received Date 19 October 2007
Original Number LL01554
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: ~2R:18219967(-)
Cytological Band: "58D3"
Gene Symbol-1: pgc
CG Number-1: CR32885
FlyBase ID-1: FBgn0016053
Insertion Type-1: CDS
Gene Symbol-2: T3dh
CG Number-2: CG3425
FlyBase ID-2: FBgn0017482
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2026-09-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 18219967
Chromosome Band 2R
Flanking Sequence
GACTTMGGATGCATGCGTGAGTTAATCTWGACTGTCACGTAAARGRTAATCRTGCGTCAC
GRRWGTGGMAWARGRACWGAKAAAACTATWAWTTACAAAKATRAGAATAAGTTGGKTTTT
GGGAGGTCCAGTCAGAATCTCCATCTATCCGCGATGACCGGCGGACTCAGGCTCAAGTTT
TGCTGGAAAMCCTGGCAGAGCTCATTCATCTCCCGCTCCCTTTGCAACTCCKCGCGCACT
TGATGCCACATGGACTcgaattaaccattgkgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE