Detailed Information [140406]
 

Strain Information
DGRC Number 140406
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL01565 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; PBac{SAstopDsRed}LL01565 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 76A3
Related Genes CG9629, CG14085
Received Date 19 October 2007
Original Number LL01565
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3L:19261669(-)
Cytological Band: "76A3"
Gene Symbol-1: CG9629
CG Number-1: CG9629
FlyBase ID-1: FBgn0036857
Insertion Type-1: Intron
Gene Symbol-2: CG14085
CG Number-2: CG14085
FlyBase ID-2: FBgn0036859
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 19261669
Chromosome Band 3L
Flanking Sequence 
tttacgcagactatctttctagggttaaATAATTTGGTCTGTAGATAAACTATMATCTTT
GATATTAAGATACTGAAAATGTGGATCACTGATAACAAATTTATAATATATGTWAATATA
TGTTTTTAATTATGCAGCATGTTGGCACAATTGAGAAATATTTcgaattaaccattgtgg
gaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE