Detailed Information [140449]
 

Strain Information
DGRC Number 140449
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL01691 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL01691 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 31E1
Related Genes RpS27A (CG5271), Ip259 (CG5277)
Received Date 19 October 2007
Original Number LL01691
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:10408621(+)
Cytological Band: "31E1"
Gene Symbol-1: RpS27A
CG Number-1: CG5271
FlyBase ID-1: FBgn0003942
Insertion Type-1: Intron
Gene Symbol-2: Ip259
CG Number-2: CG5277
FlyBase ID-2: FBgn0025366
Insertion Type-2: Intron.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 10408621
Chromosome Band 2L
Flanking Sequence 
cagactatctttnnagggttaaGGTAAGTGAATTTCCGCGTGATTAGTTATCTGTGGATG
GCCACAGAGGCTTCCCCAGGAAACAAATTTCGCACACCCCCTACCGTCCACATGTTAATA
ACCACATGAATGTATTTCAGATCTGGTCTACAGAATTAACAATTAACAATGCCGCAGAAT
GAGTATATGGAACGCCATCGCAAGCTGTATGGCCGGCGATTGGATTACGAGGAACGGAAA
CGCAAGAAGGAAGCGCGTCTTCCCAAGGACCGAGCACGAAAGGCTCGCAAGTTGCGCGGC
ATCAAGGCCAAACTCTTTAATAAGGAGCGACGCAATGAAAAGATTCAGATTAAGAAGAAG
ATCCAGGCCCACGAAGAGAAGAAGGTCAAAAAGCAGGAGGAGAAGGTcgaattaaccatt
gtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE