Detailed Information [140565]
 

Strain Information
DGRC Number 140565
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL02143 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL02143 bw1 / CyO, S* bw1
Break points/Insertion Site 57C2
Related Genes mago (CG9401), CG4050
Received Date 25 October 2007
Original Number LL02143
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: ~2R:17016185(-)
Cytological Band: 57C2
Gene Symbol-1: mago
CG Number-1: CG9401
FlyBase ID-1: FBgn0002736
Insertion Type-1: 5' UTR
Gene Symbol-2: CG4050
CG Number-2: CG4050
FlyBase ID-2: FBgn0020312
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 17016185
Chromosome Band 2R
Flanking Sequence 
TAGGGTTAAAGCGTAACTTTGAAAGACTTTCAGAAAAATATCAATTTTTGGTTTCCCACT
CTTTTTCCTTTACTACAACGCGTTAGAGATGGGAAAACACACGGAATAACTATCACCGCG
TATcgaattaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE