| Strain Information | |
|---|---|
| DGRC Number | 140588 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL02233 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1] |
| Genotype | y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL02233 P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1 |
| Break points/Insertion Site | 95F12 |
| Related Genes | BRWD3 (CG31132) |
| Received Date | 25 October 2007 |
| Original Number | LL02233 |
| Chromosome | 3 |
| Original Source | Liqun Luo, Stanford University |
| Original Comments | Location: 3R:20145992(+) Cytological Band: 95F12 Gene Symbol-1: BRWD3 CG Number-1: CG31132 FlyBase ID-1: FBgn0011785 Insertion Type-1: Intron Gene Symbol-2: CG Number-2: FlyBase ID-2: Insertion Type-2: Location coordinates are based on the Drosophila Genome release 5.0. IMPORTANT NOTES: Oren Schuldiner (Weizmann Institute of Science) |
| General Information | MARCM |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Reference | Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L. piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning. Dev Cell (2008) 14(2) 227-38 [RRC reference] |
| Last update | 2026-09-16 |
| Research papers using this strain [Please submit your publication] |
|
| Library & Clone Information |
|---|
| Strand | Plus |
| Insertion Point | 20145992 |
| Chromosome Band | 3R |
| Flanking Sequence | tttacgcagactatctttctagggttaaAAAACATTACAACTAAAGACATCAATCATTCT GACTGTTAAATTAACAAATAAGTAAGCAACTATTTAATTAAAAAGGCAGCAAAAAATTGC AAAAATTCGTAAAAGACTAAAGTGGAAAGCAAAAATTCTAAAACCCTCGTAAAAATTGTA AATTTTGAAAAATCTTAATTTTTTAAACAAATGCTTTGTAATTTAGTTTTAACAATTAGC TGCAACCAGCCGACATTTTGGTTTCTCACACATACACATGCCCATGCGCACAGACACATG CAAGCAACCACCACTTTGCCTTGACTTGTGCGCGAGGGAACGAGACAAGCATACGTTGTT GAAGCTATCGCACCGTTTATCGCCCAATcgaattaaccattgtgggaacactagaac |
| Sequence Comment | Location coordinates are based on the Drosophila Genome release 5.0. |