Detailed Information [140628]
 

Strain Information
DGRC Number 140628
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL02467 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL02467 bw1 / CyO, S* bw1
Break points/Insertion Site 59D10
Related Genes CG3530
Received Date 25 October 2007
Original Number LL02467
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: ~2R:19283983(-)
Cytological Band: 59D10
Gene Symbol-1: CG3530
CG Number-1: CG3530
FlyBase ID-1: FBgn0028497
Insertion Type-1: 5' UTR
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 19283983
Chromosome Band 2R
Flanking Sequence
ATGGGGTTAACAATCTCTTTGCCATTTTCATCCAAATTAGGGCGAAGCCTTCCGCTTGGG
CATTTAAGGAAATTTTATTCCCCGCTTTAGATGGGAACATGAGTCCTCAAAAAAAACGTA
AACAATGGACAAAATAAGCTCGCCAAGGTTAGTTATCAGCTTTCTCCTAAAGAATAAACA
TGCAAAAAAGTAATCAGGTATGTTAGAAATTGGTTCCTTCTTTCTATTGGCGCGAATCCA
TCGCTGTGCATTTAGGAATCTCTTCGCGCTTGGTGAA
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE