Detailed Information [140707]
 

Strain Information
DGRC Number 140707
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL03134 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL03134 bw1 / CyO, S* bw1
Break points/Insertion Site 54C10
Related Genes Dcr-2 (CG6493)
Received Date 25 October 2007
Original Number LL03134
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: ~2R:13469068(+)
Cytological Band: 54C10
Gene Symbol-1: Dcr-2
CG Number-1: CG6493
FlyBase ID-1: FBgn0034246
Insertion Type-1: Putative Promoter
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 13469068
Chromosome Band 2R
Flanking Sequence 
tagggttaaAGCATATTTGGGCCGAGGCCCATGGGAACTTGGGTCATTTTGACTCACGCG
GTCGAAACCCCTTAAGAATTGTGTTTCAAAACGGACTGGTCACACGACACAGTGCGGTTC
TTTGAACTTAAATTATTACCACAACCCGCAACATAAATAAATTTGTTTTGAAATGCTCGC
TGCCAATAATATACCTTCCGGAAATAATAAACGTTTCCATTTTTATcgaattaaccattg
tgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE