Detailed Information [140905]
 

Strain Information
DGRC Number 140905
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL04883 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; PBac{SAstopDsRed}LL04883 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 74C4
Related Genes CG13732, CG13733
Received Date 25 October 2007
Original Number LL04883
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3L:17472333(-)
Cytological Band: 74C4
Gene Symbol-1: CG13732
CG Number-1: CG13732
FlyBase ID-1: FBgn0036730
Insertion Type-1: Putative Promoter
Gene Symbol-2: CG13733
CG Number-2: CG13733
FlyBase ID-2: FBgn0036729
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 17472333
Chromosome Band 3L
Flanking Sequence
tatttttctagggttaaGCAAATGCCACGTGGAATGTAATCGCTTAAAAACTGGAATCAT
cgaattaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE