Detailed Information [141069]
 

Strain Information
DGRC Number 141069
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL03545 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL03545 bw1 / CyO, S* bw1
Break points/Insertion Site 46E6
Related Genes 14-3-3zeta (CG17870), CG1381
Received Date 9 November 2007
Original Number LL03545
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:5987756(+)
Cytological Band: 46E6
Gene Symbol-1: 14-3-3zeta
CG Number-1: CG17870
FlyBase ID-1: FBgn0004907
Insertion Type-1: Intron
Gene Symbol-2: CG1381
CG Number-2: CG1381
FlyBase ID-2: FBgn0033485
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 5987756
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggttaaTGACTTAAACATTATGCTTAGTGTAATACAAA
AACATCATAAATTATTAAATATATTTTCTAATTGTATAATTAACAATAGAAGAAGACTCA
AAAGAATATACTCTAATTTTGTcgaattaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE