Detailed Information [141341]
 

Strain Information
DGRC Number 141341
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL04773 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL04773 bw1 / CyO, S* bw1
Break points/Insertion Site 47B7
Related Genes Rab3 (CG7576), CG12309
Received Date 9 November 2007
Original Number LL04773
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:6614736(-)
Cytological Band: 47B7
Gene Symbol-1: Rab3
CG Number-1: CG7576
FlyBase ID-1: FBgn0005586
Insertion Type-1: Intron
Gene Symbol-2: CG12309
CG Number-2: CG12309
FlyBase ID-2: FBgn0033542
Insertion Type-2: 3' UTR.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 6614736
Chromosome Band 2R
Flanking Sequence 
tatctttctagggttaaTCCACACGCACGCGATTCAATCACTTCCGGGCACAGAGAGAAC
TCCGGTTGGCCACCAGTTGGCCTTGACCGGTGTTTCATGTGCACCATCTAGCCCCACCGG
TTCTTCGTGCAGCATGGACCACAAATGGAGTGTCTATGGATGACATAAAGGTTGATAATA
GCACATTAGCTACTcgaattaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE