Detailed Information [141373]
 

Strain Information
DGRC Number 141373
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL04868 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL04868 bw1 / CyO, S* bw1
Break points/Insertion Site 57B3
Related Genes insc (CG11312), sktl (CG9985)
Received Date 9 November 2007
Original Number LL04868
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:16719117(+)
Cytological Band: 57B3
Gene Symbol-1: insc
CG Number-1: CG11312
FlyBase ID-1: FBgn0011674
Insertion Type-1: Intron
Gene Symbol-2: sktl
CG Number-2: CG9985
FlyBase ID-2: FBgn0016984
Insertion Type-2: 5' UTR.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2026-09-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 16719117
Chromosome Band 2R
Flanking Sequence
tttacgcagactatctttctagggttaaATAGAAGAAGTCTAAAGTTAATAACTTGCCAC
TTGACCCTCGTTTTTGTGGTCGTTGTTGTTGTTGCTGTTGCTGTGGCTGCTTTTGCCTTG
GGACCATTTGTTGTGAATTATGAGCTTGCAATTATAGCGTTTTGCCGTTTTTATTTGTAA
TTTAATTAGCGTACTTACACAGAAATGCTcgaattaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE