Detailed Information [141410]
 

Strain Information
DGRC Number 141410
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL04990 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; PBac{SAstopDsRed}LL04990 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 73B1
Related Genes Pros26 (CG4097), CG4098
Received Date 9 November 2007
Original Number LL04990
Chromosome 3
Comments No Tb expression but Hu is OK. 29July2016 T.O.
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3L:16603150(+)
Cytological Band: 73B1
Gene Symbol-1: Pros26
CG Number-1: CG4097
FlyBase ID-1: FBgn0002284
Insertion Type-1: CDS
Gene Symbol-2: CG4098
CG Number-2: CG4098
FlyBase ID-2: FBgn0036648
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2023-03-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 16603150
Chromosome Band 3L
Flanking Sequence 
tttacgcagactatctttctagggTTAAAGAGTTTACTCTGCGTTCGCGAGTGAATGTTG
TAGCCGCTGCTCAGGCGGGTGTCCGCTGCAATTACGGCAAAGTCATCTCCGGCGATGGCC
ACAATGGAGCTGTAAACAGGGAAGACTCCGGTTAGATGGAGACATTCTTCCACATCTCGA
Attaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE