Detailed Information [141519]
 

Strain Information
DGRC Number 141519
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL05191 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL05191 bw1 / CyO, S* bw1
Break points/Insertion Site 55C2
Related Genes CG14502, sbb (CG5580)
Received Date 19 November 2007
Original Number LL05191
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:14176859(-)
Cytological Band: 55C2
Gene Symbol-1: CG14502
CG Number-1: CG14502
FlyBase ID-1: FBgn0034321
Insertion Type-1: Intron
Gene Symbol-2: sbb
CG Number-2: CG5580
FlyBase ID-2: FBgn0010575
Insertion Type-2: Intron.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 14176859
Chromosome Band 2R
Flanking Sequence
tttacgcagactatctttctagggTTAAGCAAAGACGTCAGGCGAAGTAAACGTTTTTTT
TTCTTTGAATACCATATAATTTTTTATTGCGAGTAATAACTTACTAGTGGGAAGTACTTA
TGGCTTATAGCTTTGGATCTTTAATAGTTGGTAACACTATTTACCTTCCTCCACTGTATT
TAGTGGGTGATAAGAGCGTAATTATTTTATTGTCATCATTTTGGCCCACTCGAAttaacc
attgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE