Detailed Information [141568]
 

Strain Information
DGRC Number 141568
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL05341 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL05341 bw1 / CyO, S* bw1
Break points/Insertion Site 46B4
Related Genes CG30001
Received Date 19 November 2007
Original Number LL05341
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:5710281(+)
Cytological Band: 46B4
Gene Symbol-1: CG30001
CG Number-1: CG30001
FlyBase ID-1: FBgn0050001
Insertion Type-1: Intron
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 5710281
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAAAATGAACTCATTTAATGTGTAGGATGAATTGC
TTACTCTGCATACGAAGCCAAAGCTATTGCCGATATTGGTAAATCCTCTATTTTCCTGCA
CATATTCCATTATAAAAACCTCCAATTATTAAAACATTCAAAATGAACAAGTATTGTTTT
TGTTGACCCGCGTGTAGTGTTACCTCAGCTATTGTGGCTGAAAATACCACACCGCTTTGA
GAGGAATCGGTTATATATATTATAGCACGCTTATCGAAttaaccattgtgggaacactag
aac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE