Detailed Information [141570]
 

Strain Information
DGRC Number 141570
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL05348 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL05348 bw1 / CyO, S* bw1
Break points/Insertion Site 54F1
Related Genes olf186-F (CG11430), olf186-M (CG14489)
Received Date 19 November 2007
Original Number LL05348
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:13735911(+)
Cytological Band: 54F1
Gene Symbol-1: olf186-F
CG Number-1: CG11430
FlyBase ID-1: FBgn0041585
Insertion Type-1: Intron
Gene Symbol-2: olf186-M
CG Number-2: CG14489
FlyBase ID-2: FBgn0015522
Insertion Type-2: 3' UTR.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 13735911
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAAGCATGTATTAAAGATGATATTTTATGAGACAT
TTTAAGCATTTGGCGTTTCTGTTTCTTATATTTATGATTATGGTTTTATTCTAAGGCGGC
AGGTTTAAAGGCCTACAATTTACATAAAACATGAGCAGATTGCGGTCTGCAGCAGATGTT
TATTTACAAAACAAAACAATAGCTTAAGCATTCCAGTTTCAAAAGATACGTACGAATCGA
Attaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE