Detailed Information [141615]
 

Strain Information
DGRC Number 141615
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL05523 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL05523 bw1 / CyO, S* bw1
Break points/Insertion Site 49A6
Related Genes CG30051, CG8830
Received Date 19 November 2007
Original Number LL05523
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:8324151(-)
Cytological Band: 49A6
Gene Symbol-1: CG30051
CG Number-1: CG30051
FlyBase ID-1: FBgn0050051
Insertion Type-1: CDS
Gene Symbol-2: CG8830
CG Number-2: CG8830
FlyBase ID-2: FBgn0033738
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 8324151
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAAGCAAAATAGGTATTGAGAAAACTGTCGAAtta
accattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE