Detailed Information [141621]
 

Strain Information
DGRC Number 141621
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL05537 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL05537 bw1 / CyO, S* bw1
Break points/Insertion Site 57D11
Related Genes dom (CG9696), CG30394
Received Date 19 November 2007
Original Number LL05537
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:17211471(+)
Cytological Band: 57D11
Gene Symbol-1: dom
CG Number-1: CG9696
FlyBase ID-1: FBgn0020306
Insertion Type-1: Intron
Gene Symbol-2: CG30394
CG Number-2: CG30394
FlyBase ID-2: FBgn0050394
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 17211471
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAAAATGATTGTAGACTTTTGTCCCGTCATGTTTG
ATAATGGATATTACGCAGCGGTAAAATTATTATTTAATGTCTGTTATTGAGTCAATGAGT
TCTGCGGTTGGGCCAGGGCTGCAGCATCGGCACATGTTCGAAttaaccattgtgggaaca
ctagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE