Detailed Information [141681]
Strain Information
DGRC Number 141681
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E PBac{SAstopDsRed}LL05743 / TM6B, Tb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E PBac{SAstopDsRed}LL05743 / TM6B, Tb1
Break points/Insertion Site 100D2
Related Genes CG1910, awd (CG2210)
Received Date 19 November 2007
Original Number LL05743
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3R:27571826(+)
Cytological Band: 100D2
Gene Symbol-1: CG1910
CG Number-1: CG1910
FlyBase ID-1: FBgn0022349
Insertion Type-1: 5' UTR
Gene Symbol-2: awd
CG Number-2: CG2210
FlyBase ID-2: FBgn0000150
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2026-09-16
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Plus
Insertion Point 27571826
Chromosome Band 3R
Flanking Sequence
tttacgcagactatctttctagggTTAAATTCCAAATCGGAAATTTGAGTGCATTGCTAA
AGTATTCATATTTTTTTAAATTTATAACCGCTCAAATGGGGCTGCCATGTCGCCTTGTAC
TTTGAATTTCAGAATGTATTCTGAATGCATTTCATCGAAttaaccattgtgggaacacta
gaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE