Detailed Information [141707]
 

Strain Information
DGRC Number 141707
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL05841 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; PBac{SAstopDsRed}LL05841 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 76D6
Related Genes Ac76E (CG7978)
Received Date 19 November 2007
Original Number LL05841
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3L:19954328(+)
Cytological Band: 76D6
Gene Symbol-1: Ac76E
CG Number-1: CG7978
FlyBase ID-1: FBgn0004852
Insertion Type-1: Intron
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 19954328
Chromosome Band 3L
Flanking Sequence 
tttacgcagactatctttctagggTTAAATCCAAATCACCTCAAAGCTTCGTGCTCTCAG
CATCGGCATTCTATATCTTGTAAAAAGACTTGTAAAATGACTGAAAATAATAATTTATAT
GACTAAAGCAGAATATCGTATAGTTTCCCACATCGAAttaaccattgtgggaacactaga
ac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE