Detailed Information [141736]
 

Strain Information
DGRC Number 141736
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL05955 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL05955 bw1 / CyO, S* bw1
Break points/Insertion Site 54B7
Related Genes Bap55 (CG6546)
Received Date 19 November 2007
Original Number LL05955
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:13317566(-)
Cytological Band: 54B7
Gene Symbol-1: Bap55
CG Number-1: CG6546
FlyBase ID-1: FBgn0025716
Insertion Type-1: CDS
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 13317566
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAAGGAGCGCGACAACGGACGCTTCACGCTGCGCA
AACTGCCAGAGAACCTAACTCAGTCGTGGCAAAACTACATGTTGCAGCTCATGATGCAAG
ACTTTCAGATGAATGTGCTGCAGGTCCTAGAAAATCCGTTCGAAttaaccattgtgggaa
cactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE