Detailed Information [141773]
 

Strain Information
DGRC Number 141773
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL06261 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL06261 P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 96B19
Related Genes CG31111, CG11819
Received Date 19 November 2007
Original Number LL06261
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3R:20882232(-)
Cytological Band: 96B19
Gene Symbol-1: CG31111
CG Number-1: CG31111
FlyBase ID-1: FBgn0051111
Insertion Type-1: Putative Promoter
Gene Symbol-2: CG11819
CG Number-2: CG11819
FlyBase ID-2: FBgn0039268
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 20882232
Chromosome Band 3R
Flanking Sequence 
tttacgcagactatctttctagggTTAAAAACATACCTTATTTTTTCAAATATCCTTAAT
TCCGAGCGCCGGAAGTAACTTTTTAACATGATTAAGTCCTTTGCAAGGTCAGAATGCCAG
ATTGAATTAGGCTAAGAGGATTTGCAAATCCATTAGGAATTTCCTTAATTTCAATTCGAA
ttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE