Detailed Information [141788]
 

Strain Information
DGRC Number 141788
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A PBac{SAstopDsRed}LL06365 P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A PBac{SAstopDsRed}LL06365 P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 41D3
Related Genes gus (CG2944), gus (CG2944)
Received Date 19 November 2007
Original Number LL06365
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:1009679(+)
Cytological Band: 41D3
Gene Symbol-1: gus
CG Number-1: CG2944
FlyBase ID-1: FBgn0026238
Insertion Type-1: 5' UTR
Gene Symbol-2: gus
CG Number-2: CG2944
FlyBase ID-2: FBgn0026238
Insertion Type-2: Intron.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 1009679
Chromosome Band 2R
Flanking Sequence
tttacgcagactatctttctagggTTAAGATAACACACGGGTTGTCCGATCACAATATAA
GTAGGCTTGCAAACGGTATTACAAAAGCGAGCCAACAAAACAGGGTGCTTATGGCATTAA
TCATAAAAGATTTCTTTTGGGCGGAATACACGGCACAATTTTTGTTAAATACTGAAAATT
CTCAATACTCAATTTTCGTTTTTGCAAATCTGGTAAGTGATTATCTTAAATTAGATATTT
TAAGTTATTTAATTAATACTGCAATTTCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE