Detailed Information [141849]
 

Strain Information
DGRC Number 141849
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL06668 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL06668 bw1 / CyO, S* bw1
Break points/Insertion Site 48D5
Related Genes CG8298, rho-7 (CG8972)
Received Date 19 November 2007
Original Number LL06668
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:7876722(-)
Cytological Band: 48D5
Gene Symbol-1: CG8298
CG Number-1: CG8298
FlyBase ID-1:
Insertion Type-1: 5' UTR
Gene Symbol-2: rho-7
CG Number-2: CG8972
FlyBase ID-2:
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 7876722
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAATGGTGTTAAGGCTCGCTAGCCGAGCAAAATAA
GCAAGTCGTGTTTTGTTGTTGTCGCTTTTTGGAACGCCAATTGTCTAGTGATGTAAAAAT
TCATTTTTTCATCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE